Tomato miRNA M00006
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 33 | 3.22 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 76 | 10.07 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 8 | 0.93 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 1 | 0.22 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 1712 | 126.28 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 408 | 314.41 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 516 | 391.44 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 924 | 658.29 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 1226 | 902.92 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 434 | 270.99 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 274 | 174.55 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 886 | 583.92 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 750 | 458.51 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 701 | 419.63 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 112 | 109.28 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 159 | 92.82 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 50 | 49.05 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 268 | 189.54 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 52 | 56.61 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 1 | 0.96 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 77 | 53.64 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 320 | 427.02 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 1713 | 716.31 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 257 | 262.8 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 6234 | 1569.13 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 206 | 58.39 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 387 | 99.01 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 118 | 56.84 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 94 | 78.09 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 109 | 61.8 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 178 | 54.92 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 509 | 133.63 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 461 | 137.98 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 378 | 114.4 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 2759 | 831.4 |
Hits on known miRNAs
hit miRNA | alignment |
cme-miR156j | -CTGGCAGAAGAGAGTGAGCA- xx||x||||||||||||||||x GTTGACAGAAGAGAGTGAGCAC |
gma-miR156k | CTGGCAGAAGAGAGTGAGCA- x||x||||||||||||||||x TTGACAGAAGAGAGTGAGCAC |
gma-miR156n | CTGGCAGAAGAGAGTGAGCA- x||x||||||||||||||||x TTGACAGAAGAGAGTGAGCAC |
gma-miR156o | CTGGCAGAAGAGAGTGAGCA- x||x||||||||||||||||x TTGACAGAAGAGAGTGAGCAC |
Precursor of miRNA M00006
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch12 | 3275456 | 3275349 | - |
CUGGCAGAAGAGAGUGAGCA
UACACAUAUAAUUAUAUAAA
CAUGUUUACAUAAUUCUUUU
GAUAUAUAUAUAUAUAAUUU
UGCGUGUGCUCACUUCUCUU
UCUGUCAA | -40.30 | NA |
structure |
|