Tomato miRNA M00012
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 6 | 0.58 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 2 | 0.27 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 6 | 0.7 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 20 | 4.31 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 1008 | 74.35 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 7 | 2.93 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 2 | 2.05 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 16 | 4.03 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 2 | 0.57 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 36 | 9.21 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 16 | 7.71 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 1 | 0.83 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 9 | 5.1 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 25 | 7.71 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 121 | 31.77 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 16 | 4.79 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 55 | 16.65 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 442 | 133.19 |
Hits on known miRNAs
hit miRNA | alignment |
gma-miR156f | TTGACAGAAGATAGAGAGCACT |||||||||||x|||||||||x TTGACAGAAGAGAGAGAGCACA |
Precursor of miRNA M00012
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch06 | 39241775 | 39241676 | - |
UUGACAGAAGAUAGAGAGCA
CUAAUGAUGAUAUGCUAAUU
UCAUUCAAUUUGGGCAGCAA
AAGCAUCUCAAUUCAUUUGU
GCUCUCUAUGCUUCUGUCAU
| -43.44 | NA |
structure |
|