 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
Tomato miRNA M00056
| sequence | Length | miRNA family | sRNA ID | target |
|---|---|---|---|---|
| GUUCAAUAAAGCUGUGGGAA | 20 | miR396 | S19864876 | click here |
Digital expression
| Sample | No. raw reads | RPM | |||
|---|---|---|---|---|---|
| ID | Organism | Cultivar | Tissue | ||
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 55 | 5.36 |
| S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 28 | 3.71 |
| S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 252 | 29.44 |
| S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 111 | 23.9 |
| S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 29 | 2.14 |
| S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 3 | 2.31 |
| S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 2 | 1.52 |
| S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 3 | 2.14 |
| S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 3 | 2.21 |
| S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 13 | 8.12 |
| S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 3 | 1.91 |
| S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 5 | 3.3 |
| S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 3 | 1.83 |
| S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 3 | 1.8 |
| S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 8 | 7.81 |
| S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 3 | 1.75 |
| S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 2 | 1.96 |
| S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 6 | 4.24 |
| S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 17 | 18.51 |
| S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 10 | 9.55 |
| S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 2 | 5.78 |
| S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 9 | 6.27 |
| S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 3 | 4 |
| S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 1 | 0.42 |
| S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 3 | 3.07 |
| S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 10 | 2.52 |
| S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 5 | 1.28 |
| S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 248 | 119.46 |
| S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 94 | 78.09 |
| S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 4 | 2.27 |
| S0708 | Solanum lycopersicum | MicroTom | flower, open | 4 | 1.23 |
| S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 9 | 2.36 |
| S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 1 | 0.3 |
| S0372 | Solanum lycopersicum | Heinz 1706 | flower | 4 | 1.21 |
| S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 1 | 0.3 |
Hits on known miRNAs
| hit miRNA | alignment |
|---|---|
| aly-miR396a-3p | GTTCAATAAAGCTGTGGGAA- ||||||||||||||||||||x GTTCAATAAAGCTGTGGGAAG |
| gma-miR396i-3p | GTTCAATAAAGCTGTGGGAA- ||||||||||||||||||||x GTTCAATAAAGCTGTGGGAAG |
| osa-miR396a-3p | GTTCAATAAAGCTGTGGGAA |||||||||||||||||||| GTTCAATAAAGCTGTGGGAA |
| osa-miR396b-3p | GTTCAATAAAGCTGTGGGAA |||||||||||||||||||| GTTCAATAAAGCTGTGGGAA |
| zma-miR396a-3p | GTTCAATAAAGCTGTGGGAA- ||||||||||||||||||||x GTTCAATAAAGCTGTGGGAAA |
| zma-miR396b-3p | GTTCAATAAAGCTGTGGGAA- ||||||||||||||||||||x GTTCAATAAAGCTGTGGGAAA |
Precursor of miRNA M00056
| genome hit of precursor | precursor | ||||||
|---|---|---|---|---|---|---|---|
| sequence ID | start | end | strand | sequence | folding energy | miRNA* | structure |
| SL2.40ch00 | 12537519 | 12537618 | + | UUUCCACAGCUUUCUUGAAC UGCAUCUACAAUUUCAAUUC AUUAUUGAAAAAGAAAAAAU UGAUUCAUAUUGUUGUUGCG GUUCAAUAAAGCUGUGGGAA | -41.30 | miRNA* | structure |
| SL2.40ch12 | 2905791 | 2905660 | - | UUUCCACAGCUUUCUUGAAC UGCAUACAUAUAACAAAAAA AUCUGAUUUUUUUUUGAUUU UUUUUUACUUUUAUAAAGAA AAAAUUUAGAUGGAAAGAAU UAAAUUGUUGCGGUUCAAUA AAGCUGUGGGAA | -43.20 | miRNA* | structure |
