Tomato miRNA M00057
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 1399 | 136.33 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 784 | 103.92 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 430 | 50.23 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 652 | 140.4 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 118 | 8.7 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 20 | 15.41 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 55 | 41.72 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 25 | 17.81 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 43 | 31.67 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 92 | 57.45 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 26 | 16.56 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 65 | 42.84 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 64 | 39.13 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 32 | 19.16 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 18 | 17.56 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 25 | 14.59 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 35 | 34.33 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 12 | 8.49 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 64 | 69.67 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 92 | 87.9 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 24 | 69.33 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 16 | 11.15 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 18 | 24.02 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 7 | 2.93 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 1 | 1.02 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 39 | 9.82 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 9 | 2.55 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 21 | 5.37 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 32 | 15.41 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 5 | 4.15 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 1 | 0.31 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 13 | 3.41 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 106 | 31.73 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 42 | 12.71 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 126 | 37.97 |
Hits on known miRNAs
hit miRNA | alignment |
aly-miR396a-3p | -TTCAATAAAGCTGTGGGAAG x|||||||||||||||||||| GTTCAATAAAGCTGTGGGAAG |
gma-miR396a-3p | TTCAATAAAGCTGTGGGAAG |||||||||||||||||||| TTCAATAAAGCTGTGGGAAG |
gma-miR396i-3p | -TTCAATAAAGCTGTGGGAAG x|||||||||||||||||||| GTTCAATAAAGCTGTGGGAAG |
Precursor of miRNA M00057
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch00 | 12537518 | 12537619 | + |
UUUUCCACAGCUUUCUUGAA
CUGCAUCUACAAUUUCAAUU
CAUUAUUGAAAAAGAAAAAA
UUGAUUCAUAUUGUUGUUGC
GGUUCAAUAAAGCUGUGGGA
AG | -42.20 | NA |
structure |
SL2.40ch12 | 2905792 | 2905659 | - |
UUUUCCACAGCUUUCUUGAA
CUGCAUACAUAUAACAAAAA
AAUCUGAUUUUUUUUUGAUU
UUUUUUUACUUUUAUAAAGA
AAAAAUUUAGAUGGAAAGAA
UUAAAUUGUUGCGGUUCAAU
AAAGCUGUGGGAAG | -44.10 | NA |
structure |
|