 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
Tomato miRNA M00060
| sequence | Length | miRNA family | sRNA ID | target |
|---|---|---|---|---|
| GUCCAAGAAAGCUGUGGGAAA | 21 | miR396 | S19186048 | click here |
Digital expression
| Sample | No. raw reads | RPM | |||
|---|---|---|---|---|---|
| ID | Organism | Cultivar | Tissue | ||
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 19 | 1.85 |
| S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 24 | 3.18 |
| S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 1491 | 174.18 |
| S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 29 | 6.24 |
| S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 27 | 1.99 |
| S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 1 | 0.25 |
| S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 3 | 0.77 |
| S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 28 | 13.49 |
| S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 11 | 9.14 |
| S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 6 | 3.4 |
| S0708 | Solanum lycopersicum | MicroTom | flower, open | 3 | 0.93 |
| S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 11 | 2.89 |
| S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 6 | 1.8 |
| S0372 | Solanum lycopersicum | Heinz 1706 | flower | 13 | 3.93 |
| S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 3 | 0.9 |
Hits on known miRNAs
| hit miRNA | alignment |
|---|---|
| cca-miR396a-3p | GTCCAAGAAAGCTGTGGGAAA ||x|||||||||||||||||| GTTCAAGAAAGCTGTGGGAAA |
Precursor of miRNA M00060
| genome hit of precursor | precursor | ||||||
|---|---|---|---|---|---|---|---|
| sequence ID | start | end | strand | sequence | folding energy | miRNA* | structure |
| SL2.40ch07 | 2628875 | 2628771 | - | UUUUCCACAGCUUUCUUGAA CUUCUUCUUGCUAAAUUUUG AUCUCUAAAUUGAUAAUUUU GAGAUGAGAUUUGAAGCUAU GAAAGUCCAAGAAAGCUGUG GGAAA | -42.10 | NA | structure |
