Tomato miRNA M00062
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 6302 | 614.1 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 7295 | 966.92 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 37715 | 4405.95 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 9850 | 2121.13 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 62 | 4.57 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 241 | 185.72 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 291 | 220.75 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 139 | 99.03 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 331 | 243.77 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 577 | 360.28 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 131 | 83.45 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 417 | 274.82 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 278 | 169.95 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 174 | 104.16 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 150 | 146.36 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 254 | 148.28 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 203 | 199.13 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 122 | 86.28 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 623 | 678.2 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 277 | 264.66 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 128 | 369.76 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 168 | 117.04 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 104 | 138.78 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 24 | 10.04 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 6 | 6.14 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 120 | 30.2 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 34 | 9.64 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 213 | 54.49 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 971 | 467.73 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 274 | 227.62 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 13 | 7.37 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 97 | 29.93 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 116 | 30.45 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 310 | 92.79 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 300 | 90.79 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 237 | 71.42 |
Hits on known miRNAs
hit miRNA | alignment |
aly-miR396a-3p | GTTCAATAAAGCTGTGGGAAG ||||||||||||||||||||| GTTCAATAAAGCTGTGGGAAG |
gma-miR396i-3p | GTTCAATAAAGCTGTGGGAAG ||||||||||||||||||||| GTTCAATAAAGCTGTGGGAAG |
Precursor of miRNA M00062
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch00 | 12537518 | 12537619 | + |
UUUUCCACAGCUUUCUUGAA
CUGCAUCUACAAUUUCAAUU
CAUUAUUGAAAAAGAAAAAA
UUGAUUCAUAUUGUUGUUGC
GGUUCAAUAAAGCUGUGGGA
AG | -42.20 | NA |
structure |
SL2.40ch12 | 2905792 | 2905659 | - |
UUUUCCACAGCUUUCUUGAA
CUGCAUACAUAUAACAAAAA
AAUCUGAUUUUUUUUUGAUU
UUUUUUUACUUUUAUAAAGA
AAAAAUUUAGAUGGAAAGAA
UUAAAUUGUUGCGGUUCAAU
AAAGCUGUGGGAAG | -44.10 | NA |
structure |
|