 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
Tomato miRNA M00064
| sequence | Length | miRNA family | sRNA ID | target |
|---|---|---|---|---|
| UUCCACAGCUUUCUUGAACUUC | 22 | miR396 | S25045582 | click here |
Digital expression
| Sample | No. raw reads | RPM | |||
|---|---|---|---|---|---|
| ID | Organism | Cultivar | Tissue | ||
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 20 | 1.95 |
| S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 9 | 1.19 |
| S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 116 | 13.55 |
| S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 653 | 140.62 |
| S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 69 | 5.09 |
| S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 10 | 7.71 |
| S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 9 | 6.83 |
| S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 9 | 6.41 |
| S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 9 | 6.63 |
| S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 15 | 9.37 |
| S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 22 | 14.01 |
| S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 17 | 11.2 |
| S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 12 | 7.34 |
| S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 7 | 4.19 |
| S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 57 | 55.61 |
| S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 70 | 40.86 |
| S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 80 | 78.47 |
| S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 71 | 50.21 |
| S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 42 | 45.72 |
| S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 53 | 50.64 |
| S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 15 | 43.33 |
| S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 46 | 32.05 |
| S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 16 | 21.35 |
| S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 2 | 0.84 |
| S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 6 | 1.51 |
| S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 15 | 3.84 |
| S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 5 | 2.41 |
| S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 1 | 0.83 |
| S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 1 | 0.57 |
| S0708 | Solanum lycopersicum | MicroTom | flower, open | 2 | 0.62 |
| S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 14 | 3.68 |
| S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 35 | 10.48 |
| S0372 | Solanum lycopersicum | Heinz 1706 | flower | 82 | 24.82 |
| S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 52 | 15.67 |
Hits on known miRNAs
| hit miRNA | alignment |
|---|---|
| gma-miR396e | TTCCACAGCTTTCTTGAACTTC ||||||||||||||||||||xx TTCCACAGCTTTCTTGAACTGT |
Precursor of miRNA M00064
| genome hit of precursor | precursor | ||||||
|---|---|---|---|---|---|---|---|
| sequence ID | start | end | strand | sequence | folding energy | miRNA* | structure |
| SL2.40ch07 | 2628873 | 2628773 | - | UUCCACAGCUUUCUUGAACU UCUUCUUGCUAAAUUUUGAU CUCUAAAUUGAUAAUUUUGA GAUGAGAUUUGAAGCUAUGA AAGUCCAAGAAAGCUGUGGG A | -40.20 | NA | structure |
