Tomato miRNA M00065
| sequence | Length | miRNA family | sRNA ID | target |
| UACGCAGGAGAGAUGAUGCUG | 21 | miR4376 |
S20850097
| NA |
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 13 | 1.27 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 67 | 8.88 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 53 | 6.19 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 1 | 0.22 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 1932 | 142.5 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 10 | 2.52 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 1 | 0.28 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 58 | 14.84 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 5 | 2.41 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 1 | 0.83 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 19 | 10.77 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 370 | 114.16 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 390 | 102.39 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 92 | 27.54 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 306 | 92.61 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 1530 | 461.05 |
Hits on known miRNAs
| hit miRNA | alignment |
| gma-miR4376-5p | TACGCAGGAGAGATGATGCTG- ||||||||||||||||x||||x TACGCAGGAGAGATGACGCTGT |
Precursor of miRNA M00065
| genome hit of precursor | precursor |
| sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
| SL2.40ch06 | 4541889 | 4541962 | + |
UACGCAGGAGAGAUGAUGCU
GGACGAUAGAGAAAAUGGGA
UUUAAUUUAUUGGCCAGCAU
CAUACUCCUGCAUA | -36.50 | NA |
structure |
|