Tomato miRNA M00067
sequence | Length | miRNA family | sRNA ID | target |
ACGCAGGAGAGAUGAUGCUGGA | 22 | miR4376 |
S05138366
| NA |
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 23 | 2.24 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 230 | 30.49 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 36 | 4.21 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 7 | 1.51 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 6411 | 472.87 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 13 | 5.44 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 27 | 6.8 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 22 | 6.24 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 189 | 48.35 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 52 | 25.05 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 17 | 14.12 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 103 | 58.4 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 737 | 227.4 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 854 | 224.2 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 369 | 110.45 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 1043 | 315.66 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 3791 | 1142.39 |
Hits on known miRNAs
hit miRNA | alignment |
sly-miR4376 | ACGCAGGAGAGATGATGCTGGA |||||||||||||||||||||| ACGCAGGAGAGATGATGCTGGA |
Precursor of miRNA M00067
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch06 | 4541890 | 4541961 | + |
ACGCAGGAGAGAUGAUGCUG
GACGAUAGAGAAAAUGGGAU
UUAAUUUAUUGGCCAGCAUC
AUACUCCUGCAU | -36.50 | NA |
structure |
|