Tomato miRNA M00068
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 3 | 0.29 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 1 | 0.13 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 1 | 0.12 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 2 | 0.43 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 7 | 0.52 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 10 | 4.18 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 30 | 7.55 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 3 | 0.85 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 30 | 7.68 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 5 | 2.41 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 3 | 2.49 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 4 | 2.27 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 1377 | 424.87 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 108 | 28.35 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 17 | 5.09 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 225 | 68.09 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 20 | 6.03 |
Hits on known miRNAs
hit miRNA | alignment |
mtr-miR4414b | TGTGAATGATGCGGGAGATAA |||||||||||||||||x||| TGTGAATGATGCGGGAGCTAA |
Precursor of miRNA M00068
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch06 | 1551779 | 1551861 | + |
UAUCUCCCGACUCAUUCAUU
CAAACGCAAUAGGAAGUAUG
UAAUCUUAUACUAUUGUGAA
UGUGUGAAUGAUGCGGGAGA
UAA | -37.60 | NA |
structure |
|