Tomato miRNA M00069
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 1498 | 145.97 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 1253 | 166.08 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 2692 | 314.49 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 3887 | 837.04 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 1760 | 129.82 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 361 | 278.19 | | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 275 | 208.62 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 175 | 124.68 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 134 | 98.69 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 391 | 244.14 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 289 | 184.11 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 255 | 168.06 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 221 | 135.11 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 142 | 85 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 456 | 444.92 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 1218 | 711.04 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 543 | 532.65 | | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 879 | 621.66 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 317 | 345.09 | | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 429 | 409.89 | | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 240 | 693.29 | | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 632 | 440.28 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 279 | 372.31 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 2 | 0.84 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 4 | 4.09 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 48 | 12.08 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 10 | 2.83 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 18 | 4.61 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 9 | 4.34 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 8 | 6.65 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 7 | 3.97 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 16 | 4.94 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 45 | 11.81 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 93 | 27.84 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 65 | 19.67 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 73 | 22 |
Hits on known miRNAs
| hit miRNA | alignment |
| ghr-miR482a | TCTTTCCTACTCCTCCCATACC |||||||||||||||||||||| TCTTTCCTACTCCTCCCATACC |
Precursor of miRNA M00069
| genome hit of precursor | precursor |
| sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
| SL2.40ch04 | 55142265 | 55142338 | + |
GGUUGUGGGUGGGGUGGAAA
GAUUUGAUAAAUCUAAUUUU
AAAGAGAUUAAAUCUUUCCU
ACUCCUCCCAUACC | -36.30 | NA |
structure |
|