Tomato miRNA M00070
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 406 | 39.56 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 732 | 97.02 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 4998 | 583.88 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 900 | 193.81 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 2521 | 185.95 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 35 | 26.97 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 37 | 28.07 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 25 | 17.81 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 27 | 19.88 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 42 | 26.23 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 23 | 14.65 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 51 | 33.61 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 43 | 26.29 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 26 | 15.56 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 9 | 8.78 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 27 | 15.76 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 22 | 21.58 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 33 | 23.34 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 31 | 33.75 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 49 | 46.82 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 23 | 66.44 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 47 | 32.74 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 63 | 84.07 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 21 | 8.78 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 7 | 7.16 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 37 | 9.31 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 33 | 9.35 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 70 | 17.91 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 111 | 53.47 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 49 | 40.71 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 93 | 52.73 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 18 | 5.55 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 32 | 8.4 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 6 | 1.8 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 7 | 2.12 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 10 | 3.01 |
Hits on known miRNAs
hit miRNA | alignment |
sly-miR5301 | TGTGGGTGGGGTGGAAAGATT ||||||||||||||||||||| TGTGGGTGGGGTGGAAAGATT |
Precursor of miRNA M00070
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch04 | 55142268 | 55142336 | + |
UGUGGGUGGGGUGGAAAGAU
UUGAUAAAUCUAAUUUUAAA
GAGAUUAAAUCUUUCCUACU
CCUCCCAUA | -34.10 | miRNA* |
structure |
|