Tomato miRNA M00072
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 13187 | 1285.01 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 18820 | 2494.5 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 889 | 103.85 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 426 | 91.74 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 2714 | 200.18 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 2 | 0.84 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 4 | 4.09 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 6 | 1.51 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 2 | 0.57 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 13 | 3.33 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 5 | 2.41 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 8 | 4.54 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 76 | 23.45 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 22 | 5.78 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 308 | 92.19 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 315 | 95.33 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 754 | 227.21 |
Hits on known miRNAs
hit miRNA | alignment |
sly-miR6024 | -TTTAGCAAGAGTTGTTTTACC x||||||||||||||||||||| TTTTAGCAAGAGTTGTTTTACC |
Precursor of miRNA M00072
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch01 | 74999812 | 74999734 | - |
GGAGAAACAACACUUGCUAA
AGGAAGUUCACCAGUCAUCU
CUUUUCUUUUGGAGUUUUUU
UAGCAAGAGUUGUUUUACC | -29.10 | NA |
structure |
|