Tomato miRNA M00073
Digital expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 18014 | 1755.37 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 19549 | 2591.13 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 597 | 69.74 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 533 | 114.78 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 1520 | 112.12 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 1 | 0.42 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 13 | 3.27 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 3 | 0.77 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 1 | 0.48 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 3 | 2.49 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 5 | 2.84 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 70 | 21.6 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 7 | 1.84 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 210 | 62.86 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 204 | 61.74 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 390 | 117.52 |
Hits on known miRNAs
| hit miRNA | alignment |
|---|
| sly-miR6024 | TTTTAGCAAGAGTTGTTTTACC
||||||||||||||||||||||
TTTTAGCAAGAGTTGTTTTACC |
Precursor of miRNA M00073
| genome hit of precursor | precursor |
|---|
| sequence ID | start | end | strand | sequence |
folding
energy | miRNA* | structure |
|---|
| SL2.40ch01 | 74999812 | 74999734 | - |
GGAGAAACAACACUUGCUAA
AGGAAGUUCACCAGUCAUCU
CUUUUCUUUUGGAGUUUUUU
UAGCAAGAGUUGUUUUACC | -29.10 | NA |
structure |
|
