Tomato miRNA M00075
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 130 | 12.67 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 68 | 9.01 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 298 | 34.81 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 129 | 27.78 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 5991 | 441.9 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 23 | 9.62 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 16 | 16.36 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 171 | 43.04 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 44 | 12.47 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 202 | 51.68 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 222 | 106.94 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 66 | 54.83 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 240 | 136.08 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 392 | 120.95 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 195 | 51.19 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 482 | 144.27 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 244 | 73.84 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 230 | 69.31 |
Hits on known miRNAs
| hit miRNA | alignment |
| sly-miR6027 | TGAATCCTTCGGCTATCCATA- |||||||||||||||||||||x TGAATCCTTCGGCTATCCATAA |
| stu-miR6027 | TGAATCCTTCGGCTATCCATA- |||||||||||||||||||||x TGAATCCTTCGGCTATCCATAA |
Precursor of miRNA M00075
| genome hit of precursor | precursor |
| sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
| SL2.40ch10 | 62182532 | 62182654 | + |
UAUGGGUAGCACAAGGAUUA
AUGUGAAACAGAAAAGUGAU
AUGCAAAGAAGAUGGAGAUU
CAAUUGUUUAUUGUUACGAA
GAAAACACUUUUGUGUUUCU
CGUGAAUCCUUCGGCUAUCC
AUA | -43.50 | miRNA* |
structure |
|