Tomato miRNA M00076
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 124 | 12.08 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 82 | 10.87 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 633 | 73.95 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 99 | 21.32 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 16392 | 1209.07 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 628 | 262.61 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 160 | 163.61 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 2531 | 637.07 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 615 | 174.31 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 3667 | 938.17 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 1029 | 495.67 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 395 | 328.14 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 1308 | 741.64 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 8334 | 2571.41 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 1819 | 477.54 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 2623 | 785.1 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 1737 | 525.69 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 834 | 251.32 |
Hits on known miRNAs
hit miRNA | alignment |
sly-miR6027 | TGAATCCTTCGGCTATCCATAA |||||||||||||||||||||| TGAATCCTTCGGCTATCCATAA |
stu-miR6027 | TGAATCCTTCGGCTATCCATAA |||||||||||||||||||||| TGAATCCTTCGGCTATCCATAA |
Precursor of miRNA M00076
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch10 | 62182531 | 62182655 | + |
UUAUGGGUAGCACAAGGAUU
AAUGUGAAACAGAAAAGUGA
UAUGCAAAGAAGAUGGAGAU
UCAAUUGUUUAUUGUUACGA
AGAAAACACUUUUGUGUUUC
UCGUGAAUCCUUCGGCUAUC
CAUAA | -44.50 | NA |
structure |
|