Tomato miRNA M00078
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 30 | 2.92 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 9 | 1.19 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 14 | 1.64 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 1 | 0.22 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 57 | 4.2 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 32 | 13.38 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 7 | 7.16 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 24 | 6.04 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 43 | 12.19 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 35 | 8.95 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 105 | 50.58 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 20 | 16.61 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 33 | 18.71 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 4 | 1.23 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 45 | 11.81 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 890 | 266.39 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 341 | 103.2 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 899 | 270.91 |
Hits on known miRNAs
No hits on known miRNAs were found |
Precursor of miRNA M00078
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch12 | 1977864 | 1977759 | - |
CAGGUGCUCACUCAGCUAAU
AGUUAUUAUUUAAGAAACUC
AAUAAUAUUGGCAGCAAGGA
GAAUGGUGACUUUCAGGAUG
AUAACUAUUGGCUGAGUGAG
CAUCAC | -50.60 | miRNA* |
structure |
SL2.40ch12 | 1979509 | 1979404 | - |
GAGGUGCUCACUCAGCUAAU
AGUUAUUGUUUAAGAAACUC
AAUAAUAUUGGCAGCAAGGA
GAAUGGUGACUUUCAGGAUG
AUAACUAUUGGCUGAGUGAG
CAUCAC | -49.70 | miRNA* |
structure |
|