Tomato miRNA M00079
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 4 | 0.39 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 5 | 0.66 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 2 | 0.23 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 7 | 0.52 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 72 | 55.48 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 61 | 46.27 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 51 | 36.33 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 60 | 44.19 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 63 | 39.34 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 83 | 52.87 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 55 | 36.25 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 46 | 28.12 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 62 | 37.11 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 252 | 245.88 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 373 | 217.75 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 211 | 206.98 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 478 | 338.06 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 110 | 119.75 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 142 | 135.67 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 32 | 92.44 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 55 | 38.32 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 7 | 9.34 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 1 | 0.42 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 18 | 4.53 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 2 | 0.57 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 22 | 5.63 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 54 | 26.01 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 8 | 6.65 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 8 | 4.54 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 11 | 3.39 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 31 | 8.14 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 2 | 0.6 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 3 | 0.91 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 9 | 2.71 |
Hits on known miRNAs
No hits on known miRNAs were found |
Precursor of miRNA M00079
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch08 | 53776411 | 53776495 | + |
UGUCGCAGAUGACUUUCGCC
CAUUUAUAGAACCACACUUU
CUUUAAUUUGAAUUCUAUGU
GGUAGGACGAGAGUCAUCUG
UGACA | -37.30 | NA |
structure |
SL2.40ch08 | 53789929 | 53790013 | + |
UGUCGCAGAUGACUUUCGCC
CAUUUAUGGAACCACACUUU
CUUUAAUUUGAAUUCUAUGU
GGUAGGACGAGAGUCAUCUG
UGACA | -38.30 | NA |
structure |
SL2.40ch12 | 6988968 | 6988874 | - |
UGUCGCAGAUGACUUUCGCC
CUUCUAAGGAACCACACUUU
CUGUAAAUCUAAUUAAUUUG
AAUUCAAUGUGGCAGGACGA
GAGUCAUCUGUGACA | -37.34 | NA |
structure |
|