Tomato miRNA M00086
Digital expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 166 | 16.18 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 770 | 102.06 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 487 | 56.89 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 118 | 25.41 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 28 | 2.07 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 2 | 0.5 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 3 | 1.45 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 3 | 2.49 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 4 | 1.23 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 6 | 1.58 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 3 | 0.91 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 6 | 1.81 |
Hits on known miRNAs
| No hits on known miRNAs were found |
Precursor of miRNA M00086
| genome hit of precursor | precursor |
|---|
| sequence ID | start | end | strand | sequence |
folding
energy | miRNA* | structure |
|---|
| SL2.40ch01 | 74999810 | 74999736 | - |
AGAAACAACACUUGCUAAAG
GAAGUUCACCAGUCAUCUCU
UUUCUUUUGGAGUUUUUUUA
GCAAGAGUUGUUUUA | -27.40 | NA |
structure |
|
