Tomato miRNA M00089

sequenceLengthmiRNA familysRNA IDtarget
GGGGCAACUUGAGAUCACAUG21NA S18299735 NA

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739Solanum lycopersicumAilsa Craigfruit, red ripe (52 days after anthesis)111.07
S0738Solanum lycopersicumAilsa Craigfruit, breaker (42 days after anthesis)678.88
S0737Solanum lycopersicumAilsa Craigfruit, mature green (39 days after anthesis)607.01
S0736Solanum lycopersicumAilsa Craigfruit, immature (17 days after anthesis)357.54
S0735Solanum lycopersicumSunnyleaf , TSWV-infected705.16
S0734Solanum lycopersicumIL8-3-1seedlings, two-week-old 32.31
S0733Solanum lycopersicumIL8-3seedlings, two-week-old 21.52
S0732Solanum lycopersicumIL8-2-1seedlings, two-week-old 21.42
S0725Solanum lycopersicum x S. pennelliiM82 x LA716 (F2)seedlings, two-week-old , replicate31514.64
S0723Solanum lycopersicum x S. pennelliiM82 x LA716 (F2)seedlings, two-week-old , replicate110.98
S0721Solanum lycopersicum x S. pennelliiM82 x LA716 (F1)seedlings, two-week-old , replicate11718.51
S0717Solanum lycopersicumM82seedlings, two-week-old , replicate111.33
S0714Solanum lycopersicumMicroTom fruit , 3 days post breaker20.5
S0712Solanum lycopersicumMicroTom fruit , mature green10.26
S0373Solanum lycopersicumHeinz 1706fruit308.98
S0372Solanum lycopersicumHeinz 1706flower8325.12
S0371Solanum lycopersicumHeinz 1706leaf420126.56

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00089

genome hit of precursorprecursor
sequence IDstartendstrandsequence folding
energy		miRNA*structure
SL2.40ch126512528265125370+ GGGGCAACUUGAGAUCACAU
GUUGUCAUUUUUUUCUUUUU
GAUUUGAUUCGAUGAAUCAG
UAUCUCAACAUGUGUUCUCA
GGUUACCCC		-37.53NA structure