Tomato Functional Genomics Database (TFGD)

Tomato miRNA M00092

sequence	Length	miRNA family	sRNA ID	target
CAUGGCAGGAAGACAUGAGGC	21	NA	S13318185	NA

Digital expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	34	3.31
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	14	1.86
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	3	0.35
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	1	0.22
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	135	104.03
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	52	39.45
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	54	38.47
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	103	75.86
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	106	66.19
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	106	67.53
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	56	36.91
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	59	36.07
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	81	48.49
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	62	60.49
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	172	100.41
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	134	131.45
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	126	89.11
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	29	31.57
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	1	2.89
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	76	52.94
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	105	140.12
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	7	2.93
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	3	3.07
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	16	4.03
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	3	0.85
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	16	4.09
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	82	39.5
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	85	70.61
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	51	28.92
S0708	Solanum lycopersicum	MicroTom	flower, open	16	4.94
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	64	16.8
S0372	Solanum lycopersicum	Heinz 1706	flower	3	0.91

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00092

genome hit of precursor				precursor
sequence ID	start	end	strand	sequence	folding energy	miRNA*	structure
SL2.40ch04	4907566	4907643	+	CAUGGCAGGAAGACAUGAGG CAUUAGUAUGUAUAUUGUGU AAAUUUUAAAUACUAAUGCC UCAUGCCUUCCUGCCAUG	-48.40	NA	structure