Tomato miRNA M00092
| sequence | Length | miRNA family | sRNA ID | target |
| CAUGGCAGGAAGACAUGAGGC | 21 | NA |
S13318185
| NA |
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 34 | 3.31 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 14 | 1.86 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 3 | 0.35 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 1 | 0.22 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 135 | 104.03 | | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 52 | 39.45 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 54 | 38.47 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 103 | 75.86 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 106 | 66.19 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 106 | 67.53 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 56 | 36.91 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 59 | 36.07 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 81 | 48.49 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 62 | 60.49 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 172 | 100.41 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 134 | 131.45 | | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 126 | 89.11 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 29 | 31.57 | | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 1 | 2.89 | | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 76 | 52.94 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 105 | 140.12 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 7 | 2.93 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 3 | 3.07 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 16 | 4.03 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 3 | 0.85 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 16 | 4.09 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 82 | 39.5 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 85 | 70.61 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 51 | 28.92 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 16 | 4.94 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 64 | 16.8 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 3 | 0.91 |
Hits on known miRNAs
| No hits on known miRNAs were found |
Precursor of miRNA M00092
| genome hit of precursor | precursor |
| sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
| SL2.40ch04 | 4907566 | 4907643 | + |
CAUGGCAGGAAGACAUGAGG
CAUUAGUAUGUAUAUUGUGU
AAAUUUUAAAUACUAAUGCC
UCAUGCCUUCCUGCCAUG | -48.40 | NA |
structure |
|