Tomato miRNA M00094
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 3 | 0.29 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 7 | 0.93 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 51 | 5.96 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 2 | 0.43 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 322 | 23.75 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 1 | 0.25 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 4 | 1.02 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 1 | 0.31 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 457 | 136.79 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 131 | 39.65 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 641 | 193.16 |
Hits on known miRNAs
No hits on known miRNAs were found |
Precursor of miRNA M00094
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch11 | 36953055 | 36952890 | - |
AACGGUGAUAAUGGUAUUCU
AAUAUUGCUAAAGUUAGACA
GAUUUACUGCCUUUUGUUAU
UUCAGAUGCAGGAACACCAA
UACAAGAAGCAAUGAGCUUG
CUUGGGCAUGUCAAAAGCCG
UAAAUCCAUUCAAUUUUAGC
AAUAUUGGAAUACCAUCAUC
ACCGUU | -71.31 | miRNA* |
structure |
|