Tomato miRNA M00095
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 64 | 4.72 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 512 | 214.1 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 35 | 35.79 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 469 | 118.05 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 134 | 37.98 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 128 | 32.75 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 1 | 0.83 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 4 | 1.23 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 9 | 2.69 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 4 | 1.21 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 13 | 3.92 |
Hits on known miRNAs
No hits on known miRNAs were found |
Precursor of miRNA M00095
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch01 | 3116752 | 3116834 | + |
UCUCUCCAGUCACCUCAUCC
GUAUUUCUCGAAUAGGUUGC
UAAUUCAAGCAUUAGAGAAA
UAUGGAAGAGGUGAUUGGAG
AAA | -46.40 | NA |
structure |
|