Tomato miRNA M00096
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 20 | 1.48 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 31 | 23.89 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 26 | 19.72 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 22 | 15.67 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 5 | 3.68 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 26 | 16.23 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 27 | 17.2 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 21 | 13.84 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 26 | 15.9 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 22 | 13.17 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 90 | 87.81 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 178 | 103.91 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 84 | 82.4 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 325 | 229.85 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 26 | 28.3 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 86 | 82.17 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 39 | 112.66 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 11 | 7.66 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 12 | 16.01 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 4 | 1.13 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 1 | 0.57 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 15 | 4.63 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 7 | 1.84 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 2 | 0.61 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 1 | 0.3 |
Hits on known miRNAs
No hits on known miRNAs were found |
Precursor of miRNA M00096
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch02 | 39361448 | 39361373 | - |
AUAUUGGUGCGGUUCAAUUA
GAAAGCGCACUUCUUUAUAU
AUAGAACUUCGUUAUUUAAU
UGAGCCGUGCCAAUAU | -35.30 | miRNA* |
structure |
|