Tomato miRNA M00097
sequence | Length | miRNA family | sRNA ID | target |
AUAAAGCUGUGGGAAGAUACA | 21 | NA |
S08817826
| NA |
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 52 | 5.07 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 86 | 11.4 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 56 | 6.54 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 10 | 2.15 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 172 | 12.69 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 6 | 4.62 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 10 | 7.59 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 16 | 11.4 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 14 | 10.31 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 21 | 13.11 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 7 | 4.46 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 14 | 9.23 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 6 | 3.67 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 7 | 4.19 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 2 | 1.95 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 9 | 5.25 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 12 | 11.77 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 2 | 1.41 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 5 | 5.44 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 1 | 0.96 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 1 | 2.89 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 3 | 2.09 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 11 | 14.68 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 6 | 1.51 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 12 | 3.07 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 4 | 1.93 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 1 | 0.83 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 11 | 3.39 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 6 | 1.58 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 345 | 103.26 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 253 | 76.57 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 767 | 231.13 |
Hits on known miRNAs
No hits on known miRNAs were found |
Precursor of miRNA M00097
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch00 | 12537513 | 12537624 | + |
UGUGUUUUUCCACAGCUUUC
UUGAACUGCAUCUACAAUUU
CAAUUCAUUAUUGAAAAAGA
AAAAAUUGAUUCAUAUUGUU
GUUGCGGUUCAAUAAAGCUG
UGGGAAGAUACA | -49.90 | NA |
structure |
SL2.40ch12 | 2905797 | 2905654 | - |
UGUACUUUUCCACAGCUUUC
UUGAACUGCAUACAUAUAAC
AAAAAAAUCUGAUUUUUUUU
UGAUUUUUUUUUACUUUUAU
AAAGAAAAAAUUUAGAUGGA
AAGAAUUAAAUUGUUGCGGU
UCAAUAAAGCUGUGGGAAGA
UACA | -47.70 | NA |
structure |
|