Tomato Functional Genomics Database (TFGD)

Tomato miRNA M00100

sequence	Length	miRNA family	sRNA ID	target
AUGGCAGGAAGACAUGAGGCA	21	NA	S11184965	click here

Digital expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	1	0.1
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	3	0.65
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	2	0.15
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	223	171.85
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	148	112.27
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	123	87.63
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	190	139.93
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	318	198.56
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	313	199.39
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	133	87.65
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	184	112.49
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	155	92.79
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	141	137.57
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	379	221.25
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	202	198.15
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	383	270.87
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	89	96.89
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	2	1.91
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	1	2.89
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	187	130.27
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	121	161.47
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	17	7.11
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	16	16.36
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	51	12.84
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	44	12.47
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	70	17.91
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	386	185.94
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	175	145.38
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	383	217.16
S0708	Solanum lycopersicum	MicroTom	flower, open	53	16.35
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	218	57.23
S0373	Solanum lycopersicum	Heinz 1706	fruit	3	0.9
S0372	Solanum lycopersicum	Heinz 1706	flower	13	3.93
S0371	Solanum lycopersicum	Heinz 1706	leaf	3	0.9

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00100

genome hit of precursor				precursor
sequence ID	start	end	strand	sequence	folding energy	miRNA*	structure
SL2.40ch04	4907567	4907642	+	AUGGCAGGAAGACAUGAGGC AUUAGUAUGUAUAUUGUGUA AAUUUUAAAUACUAAUGCCU CAUGCCUUCCUGCCAU	-45.80	NA	structure