Tomato miRNA M00101
sequence | Length | miRNA family | sRNA ID | target |
CGGUUCAAUAAAGCUGUGGGA | 21 | NA |
S14134810
| NA |
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 24 | 2.34 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 9 | 1.19 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 18 | 2.1 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 4 | 0.86 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 16 | 12.33 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 20 | 15.17 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 7 | 4.99 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 7 | 5.16 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 31 | 19.36 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 17 | 10.83 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 38 | 25.04 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 9 | 5.5 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 6 | 3.59 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 46 | 44.88 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 39 | 22.77 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 76 | 74.55 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 52 | 36.78 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 171 | 186.15 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 309 | 295.24 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 38 | 109.77 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 6 | 4.18 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 1 | 1.33 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 12 | 3.02 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 7 | 1.79 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 3 | 1.45 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 2 | 0.62 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 1 | 0.3 |
Hits on known miRNAs
No hits on known miRNAs were found |
Precursor of miRNA M00101
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch00 | 12537520 | 12537617 | + |
UUCCACAGCUUUCUUGAACU
GCAUCUACAAUUUCAAUUCA
UUAUUGAAAAAGAAAAAAUU
GAUUCAUAUUGUUGUUGCGG
UUCAAUAAAGCUGUGGGA | -40.30 | miRNA* |
structure |
SL2.40ch12 | 2905790 | 2905661 | - |
UUCCACAGCUUUCUUGAACU
GCAUACAUAUAACAAAAAAA
UCUGAUUUUUUUUUGAUUUU
UUUUUACUUUUAUAAAGAAA
AAAUUUAGAUGGAAAGAAUU
AAAUUGUUGCGGUUCAAUAA
AGCUGUGGGA | -42.20 | miRNA* |
structure |
|