Tomato miRNA M00103
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 11 | 1.46 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 572 | 66.82 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 29 | 6.24 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 208 | 15.34 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 190 | 79.45 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 27 | 27.61 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 288 | 72.49 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 23 | 6.52 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 1171 | 299.59 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 179 | 86.22 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 49 | 40.71 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 58 | 32.89 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 718 | 221.53 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 724 | 190.07 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 24 | 7.18 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 21 | 6.36 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 51 | 15.37 |
Hits on known miRNAs
No hits on known miRNAs were found |
Precursor of miRNA M00103
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch05 | 60646112 | 60646321 | + |
GGCAUAUGUCAAGUAUUAUG
GGAAAUGUUAUUGUAAUUCA
CACGUUGAAUAUAUCUCAUA
AUGAAUGCAAUGUCAUAUAC
CAUCAACACUUGGAAACUCA
AAUUGAGGUUAAAUCUCGGA
GUGAUGAUGGUAUAUGACCU
UGCAAUUCACUAUGAGAUAA
GUUCAACGUGUGAAUUGCCA
UAAGAUCUCCCAUAAUGCUU
GGAAUAUGCC | -118.80 | NA |
structure |
|