Tomato miRNA M00105
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 3017 | 293.99 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 1419 | 188.08 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 1705 | 199.18 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 673 | 144.93 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 5137 | 378.9 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 5 | 2.09 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 2 | 2.05 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 14 | 3.52 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 4 | 1.13 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 11 | 2.81 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 2 | 0.96 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 2 | 1.66 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 14 | 7.94 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 28 | 8.64 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 41 | 10.76 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 417 | 124.81 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 177 | 53.57 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 419 | 126.26 |
Hits on known miRNAs
No hits on known miRNAs were found |
Precursor of miRNA M00105
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch05 | 60646152 | 60646281 | + |
CACGUUGAAUAUAUCUCAUA
AUGAAUGCAAUGUCAUAUAC
CAUCAACACUUGGAAACUCA
AAUUGAGGUUAAAUCUCGGA
GUGAUGAUGGUAUAUGACCU
UGCAAUUCACUAUGAGAUAA
GUUCAACGUG | -67.40 | NA |
structure |
|