Tomato miRNA M00106
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 21 | 2.05 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 3 | 0.4 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 18 | 2.1 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 3860 | 284.71 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 1 | 0.42 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 1 | 0.25 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 6 | 1.54 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 2 | 0.96 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 1 | 0.57 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 1 | 0.31 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 2 | 0.53 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 872 | 261 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 316 | 95.63 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 1369 | 412.54 |
Hits on known miRNAs
No hits on known miRNAs were found |
Precursor of miRNA M00106
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch11 | 36953076 | 36952869 | - |
UUCACUGUGUGAGAUGGUAA
UAACGGUGAUAAUGGUAUUC
UAAUAUUGCUAAAGUUAGAC
AGAUUUACUGCCUUUUGUUA
UUUCAGAUGCAGGAACACCA
AUACAAGAAGCAAUGAGCUU
GCUUGGGCAUGUCAAAAGCC
GUAAAUCCAUUCAAUUUUAG
CAAUAUUGGAAUACCAUCAU
CACCGUUAUUACCACCUGGC
ACAGUGAA | -103.61 | miRNA* |
structure |
|