Tomato miRNA M00108
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 30 | 2.92 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 71 | 9.41 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 72 | 8.41 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 6 | 1.29 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 880 | 64.91 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 107 | 44.74 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 23 | 23.52 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 146 | 36.75 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 44 | 12.47 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 114 | 29.17 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 3 | 1.7 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 116 | 35.79 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 32 | 8.4 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 355 | 106.26 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 130 | 39.34 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 1528 | 460.45 |
Hits on known miRNAs
No hits on known miRNAs were found |
Precursor of miRNA M00108
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch11 | 36953069 | 36952876 | - |
UGUGAGAUGGUAAUAACGGU
GAUAAUGGUAUUCUAAUAUU
GCUAAAGUUAGACAGAUUUA
CUGCCUUUUGUUAUUUCAGA
UGCAGGAACACCAAUACAAG
AAGCAAUGAGCUUGCUUGGG
CAUGUCAAAAGCCGUAAAUC
CAUUCAAUUUUAGCAAUAUU
GGAAUACCAUCAUCACCGUU
AUUACCACCUGGCA | -89.61 | miRNA* |
structure |
|