Tomato miRNA M00110
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 2 | 0.19 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 1 | 0.13 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 3 | 0.35 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 4 | 0.86 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 12600 | 929.37 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 5 | 1.28 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 3 | 1.7 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 31 | 9.56 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 16 | 4.2 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 108 | 32.33 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 618 | 187.03 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 74 | 22.3 |
Hits on known miRNAs
No hits on known miRNAs were found |
Precursor of miRNA M00110
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch08 | 59305785 | 59305677 | - |
UAACCCCGAUAAAAUCUAAG
UUUCCAAAGGCUUUAAUGUU
ACUCGUCAAGUAAAUGGUGA
UGAGUUGGUAAUGUUAAGGU
UUUUGGAAUCUUGGAUUUUA
UCGGAGUUA | -52.00 | NA |
structure |
|