Tomato miRNA M00111
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 113 | 11.01 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 77 | 10.21 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 61 | 7.13 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 23 | 4.95 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 42748 | 3153.09 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 4 | 1.67 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 1 | 1.02 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 13 | 3.27 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 6 | 1.7 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 5 | 1.28 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 1 | 0.57 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 4 | 1.23 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 1259 | 376.84 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 111 | 33.59 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 172 | 51.83 |
Hits on known miRNAs
| No hits on known miRNAs were found |
Precursor of miRNA M00111
| genome hit of precursor | precursor |
| sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
| SL2.40ch08 | 56132649 | 56132785 | + |
UUUCAGUAGACGUUGUGAAU
AAUUGAUAAAUACAGGUAUA
CAGAGGUCUUAAUAUAGUCA
GAACCUAGAAAUAUGUGUAA
CUAGAUUCAGACCUUUGUAC
ACUUGUAUUCUGUUGCUAUU
CACAAUCUCUGCUGAAA | -57.30 | NA |
structure |
|