Tomato Functional Genomics Database (TFGD)

Tomato miRNA M00114

sequence	Length	miRNA family	sRNA ID	target
UGUCGCAGAUGACUUUCGCCC	21	NA	S24047119	click here

Digital expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	4621	450.29
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	3515	465.9
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	288	33.64
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	393	84.63
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	3121	230.2
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	1447	1115.08
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	683	518.13
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	566	403.24
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	551	405.8
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	753	470.18
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	1157	737.06
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	914	602.37
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	943	576.5
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	950	568.68
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	6214	6063
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	11399	6654.43
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	6620	6493.79
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	13086	9254.85
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	3502	3812.29
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	3986	3808.45
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	418	1207.49
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	1245	867.32
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	269	358.96
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	71	29.69
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	9	9.2
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	174	43.8
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	48	13.6
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	200	51.17
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	180	86.71
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	46	38.21
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	61	34.59
S0708	Solanum lycopersicum	MicroTom	flower, open	286	88.24
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	564	148.07
S0373	Solanum lycopersicum	Heinz 1706	fruit	1368	409.46
S0372	Solanum lycopersicum	Heinz 1706	flower	908	274.8
S0371	Solanum lycopersicum	Heinz 1706	leaf	1057	318.52

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00114

genome hit of precursor				precursor
sequence ID	start	end	strand	sequence	folding energy	miRNA*	structure
SL2.40ch08	53776411	53776495	+	UGUCGCAGAUGACUUUCGCC CAUUUAUAGAACCACACUUU CUUUAAUUUGAAUUCUAUGU GGUAGGACGAGAGUCAUCUG UGACA	-37.30	NA	structure
SL2.40ch12	6988968	6988874	-	UGUCGCAGAUGACUUUCGCC CUUCUAAGGAACCACACUUU CUGUAAAUCUAAUUAAUUUG AAUUCAAUGUGGCAGGACGA GAGUCAUCUGUGACA	-37.34	NA	structure