Tomato miRNA M00118
sequence | Length | miRNA family | sRNA ID | target |
UAGCCUGAACCUGCAUCGUGAU | 22 | NA |
S21095492
| NA |
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 5 | 0.49 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 1 | 0.13 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 35 | 4.09 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 9 | 1.94 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 1604 | 118.31 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 2 | 0.84 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 2 | 0.5 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 2 | 0.57 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 1 | 0.26 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 2 | 0.96 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 1 | 0.83 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 2 | 1.13 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 16 | 4.94 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 8 | 2.1 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 156 | 46.69 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 94 | 28.45 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 203 | 61.17 |
Hits on known miRNAs
No hits on known miRNAs were found |
Precursor of miRNA M00118
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch03 | 61427686 | 61427829 | + |
UAGCCUGAACCUGCAUCGUG
AUGGCCUGUGCCAUCUGGGU
UAGAGAUGCUCUCACCUCAA
AUCAGAAUAAUAAGUCCACA
UCAACCAUAUUAAGGGCAUC
UCUAGCCCAGAUGGCACAUG
CCAUCACGAUGUAGGCUCAG
GCUA | -95.10 | miRNA* |
structure |
|