Tomato miRNA M00120
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 1820 | 134.24 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 1 | 0.48 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 2 | 1.13 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 2 | 0.62 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 24 | 7.18 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 88 | 26.63 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 17 | 5.12 |
Hits on known miRNAs
No hits on known miRNAs were found |
Precursor of miRNA M00120
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch08 | 59305786 | 59305676 | - |
UUAACCCCGAUAAAAUCUAA
GUUUCCAAAGGCUUUAAUGU
UACUCGUCAAGUAAAUGGUG
AUGAGUUGGUAAUGUUAAGG
UUUUUGGAAUCUUGGAUUUU
AUCGGAGUUAA | -53.00 | NA |
structure |
|