Tomato miRNA M00124
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 250 | 24.36 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 417 | 55.27 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 118 | 13.79 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 4 | 0.86 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 2229 | 164.41 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 2 | 2.05 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 10 | 2.52 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 8 | 2.05 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 2 | 0.96 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 3 | 1.7 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 13 | 4.01 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 6 | 1.58 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 425 | 127.21 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 261 | 78.99 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 611 | 184.12 |
Hits on known miRNAs
No hits on known miRNAs were found |
Precursor of miRNA M00124
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch01 | 832354 | 832559 | + |
AAUACAACUAUAGCCAAGAC
AAUGCUUCAUUAUAAGUGCA
UAACUUUUCACUUUAUUGUU
UGAGCAUUGUGUUGAUUUCU
CUAAACUUGUUUUUCGUUGA
ACAAGAUUGUUUUUUCAUAU
ACUCAUGGAAAGCAACACCG
UGCUCAGAAGUUAGAGUGAA
AUGUUAUGCAUUUGUGAUUA
UAUAUUUUCUUGGCUAGAGU
UGUAUU | -89.30 | NA |
structure |
|