Tomato miRNA M00126
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 581 | 56.62 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 740 | 98.08 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 755 | 88.2 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 1176 | 253.24 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 1051 | 77.52 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 4 | 1.67 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 8 | 2.01 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 1 | 0.28 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 6 | 1.54 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 9 | 4.34 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 1 | 0.83 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 10 | 5.67 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 10 | 3.09 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 3 | 0.79 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 152 | 45.5 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 248 | 75.06 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 218 | 65.69 |
Hits on known miRNAs
| No hits on known miRNAs were found |
Precursor of miRNA M00126
| genome hit of precursor | precursor |
| sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
| SL2.40ch10 | 62182533 | 62182653 | + |
AUGGGUAGCACAAGGAUUAA
UGUGAAACAGAAAAGUGAUA
UGCAAAGAAGAUGGAGAUUC
AAUUGUUUAUUGUUACGAAG
AAAACACUUUUGUGUUUCUC
GUGAAUCCUUCGGCUAUCCA
U | -42.20 | miRNA* |
structure |
|