Tomato miRNA M00131
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 736 | 71.72 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 2573 | 341.04 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 249 | 29.09 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 35 | 7.54 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 244 | 18 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 1 | 0.42 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 1 | 0.25 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 5 | 1.42 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 15 | 3.84 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 33 | 10.18 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 11 | 2.89 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 149 | 44.6 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 35 | 10.59 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 86 | 25.92 |
Hits on known miRNAs
No hits on known miRNAs were found |
Precursor of miRNA M00131
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch05 | 60646173 | 60646260 | + |
UGAAUGCAAUGUCAUAUACC
AUCAACACUUGGAAACUCAA
AUUGAGGUUAAAUCUCGGAG
UGAUGAUGGUAUAUGACCUU
GCAAUUCA | -40.00 | NA |
structure |
|