Tomato miRNA M00134
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 1 | 0.1 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 2 | 0.43 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 89 | 6.56 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 92 | 70.9 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 9 | 6.83 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 13 | 9.26 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 130 | 95.74 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 38 | 23.73 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 14 | 8.92 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 54 | 35.59 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 94 | 57.47 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 33 | 19.75 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 4 | 3.9 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 8 | 4.67 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 5 | 4.9 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 10 | 7.07 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 38 | 41.37 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 16 | 15.29 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 10 | 28.89 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 44 | 30.65 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 60 | 80.07 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 153 | 63.98 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 117 | 119.64 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 305 | 76.77 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 774 | 219.37 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 389 | 99.52 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 784 | 377.65 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 1234 | 1025.13 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 2518 | 1427.71 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 311 | 95.96 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 924 | 242.57 |
Hits on known miRNAs
No hits on known miRNAs were found |
Precursor of miRNA M00134
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch02 | 45487030 | 45487197 | + |
CAUCUUCCUGGCUAUAUUCC
CUUGUAAAGUGUCCCUCUUC
GCCGCAUUUGUAGCAUCCCG
CUAUUCCUCCACCGCCUCCC
UGGCUACAUUCCCUUGCGAA
AGAAGGAGGGGGCUGCUACA
AAUGUGGGGAAGAAGGGCAU
UUUGGAAGGGAUUGUAGGCA
GAGAGAUG | -95.00 | NA |
structure |
SL2.40ch02 | 45483333 | 45483500 | + |
CAUCUUCCUGGCUAUAUUCC
CUUGUAAAGUGUCCUUCUUG
UCCGCAUUUGUAGCAUCCCG
CUCCUCCUCCACCGCCUCCU
UGGCUACAUUCCCUUGUGAA
AGAAGGAAGGGGCUGCUACA
AAUGUGGGGAAGAAGGGCAU
UUUGGAAGGGAUUGUAGGCA
GAGAGAUG | -95.50 | NA |
structure |
|