Tomato miRNA M00137
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 3 | 0.29 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 5 | 0.66 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 5 | 0.58 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 2 | 0.43 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 39 | 2.88 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 18 | 7.53 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 41 | 10.32 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 12 | 3.4 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 56 | 14.33 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 88 | 42.39 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 58 | 48.18 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 214 | 121.34 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 13 | 4.01 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 43 | 11.29 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 24 | 7.18 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 26 | 7.87 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 6 | 1.81 |
Hits on known miRNAs
| No hits on known miRNAs were found |
Precursor of miRNA M00137
| genome hit of precursor | precursor |
| sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
| SL2.40ch01 | 831473 | 831534 | + |
GUUCAAUUUGUUUGCCCUAC
UUUACUUUUAAAGUAAAGUA
AAGUGAGACGAACAAAUUGA
AU | -26.40 | miRNA* |
structure |
|