Tomato miRNA M00140
sequence | Length | miRNA family | sRNA ID | target |
GCUGACGGCAUUAGAUUGAUAUA | 23 | NA |
S17569846
| NA |
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 1 | 0.12 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 4 | 0.3 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 79 | 60.88 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 73 | 55.38 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 73 | 52.01 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 87 | 64.07 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 89 | 55.57 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 59 | 37.59 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 55 | 36.25 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 85 | 51.96 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 79 | 47.29 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 71 | 69.27 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 108 | 63.05 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 68 | 66.7 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 33 | 23.34 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 60 | 65.32 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 41 | 39.17 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 46 | 132.88 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 98 | 68.27 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 100 | 133.44 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 113 | 47.25 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 34 | 34.77 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 103 | 25.93 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 189 | 53.57 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 118 | 30.19 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 24 | 11.56 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 22 | 18.28 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 6 | 3.4 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 40 | 12.34 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 47 | 12.34 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 1 | 0.3 |
Hits on known miRNAs
No hits on known miRNAs were found |
Precursor of miRNA M00140
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch01 | 5704069 | 5703914 | - |
GCUGACGGCAUUAGAUUGAU
AUAUGUUACUCACAGUAAUG
UUUUACUCAUAAUACGUUAC
UUACAGUAACGUUUUAGGCG
UAAAACGUUACUCAAAAUAA
CGUUUUAGGAGUAAAACCGU
AUUUACAGUAACGUAUAUCA
ACCUAACACUGUUAGU | -63.00 | NA |
structure |
|