Tomato miRNA M00141

sequenceLengthmiRNA familysRNA IDtarget
UGGACGGCGAGGACAUGAGUGAA23NA S23636860 NA

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0738Solanum lycopersicumAilsa Craigfruit, breaker (42 days after anthesis)10.13
S0737Solanum lycopersicumAilsa Craigfruit, mature green (39 days after anthesis)10.12
S0736Solanum lycopersicumAilsa Craigfruit, immature (17 days after anthesis)10.22
S0734Solanum lycopersicumIL8-3-1seedlings, two-week-old 134103.26
S0733Solanum lycopersicumIL8-3seedlings, two-week-old 9874.34
S0732Solanum lycopersicumIL8-2-1seedlings, two-week-old 13495.47
S0731Solanum lycopersicumIL8-2seedlings, two-week-old 150110.47
S0730Solanum lycopersicumIL8-1-3seedlings, two-week-old 12376.8
S0729Solanum lycopersicumIL8-1Dseedlings, two-week-old 12177.08
S0728Solanum lycopersicumIL8-1-1seedlings, two-week-old 159104.79
S0727Solanum lycopersicumIL2-5seedlings, two-week-old 15997.2
S0726Solanum lycopersicumIL1-1seedlings, two-week-old 224134.09
S0725Solanum lycopersicum x S. pennelliiM82 x LA716 (F2)seedlings, two-week-old , replicate31716.59
S0724Solanum lycopersicum x S. pennelliiM82 x LA716 (F2)seedlings, two-week-old , replicate24023.35
S0723Solanum lycopersicum x S. pennelliiM82 x LA716 (F2)seedlings, two-week-old , replicate13130.41
S0722Solanum lycopersicum x S. pennelliiM82 x LA716 (F1)seedlings, two-week-old , replicate23121.92
S0721Solanum lycopersicum x S. pennelliiM82 x LA716 (F1)seedlings, two-week-old , replicate14953.34
S0720Solanum pennelliiLA716seedlings, two-week-old , replicate23634.4
S0719Solanum pennelliiLA716seedlings, two-week-old , replicate11234.66
S0718Solanum lycopersicumM82seedlings, two-week-old , replicate2159110.77
S0717Solanum lycopersicumM82seedlings, two-week-old , replicate1101134.78
S0716Solanum lycopersicumMicroTom fruit , 7 days post breaker93.76
S0715Solanum lycopersicumMicroTom fruit , 5 days post breaker33.07
S0714Solanum lycopersicumMicroTom fruit , 3 days post breaker153.78
S0713Solanum lycopersicumMicroTom fruit , breaker stage4613.04
S0712Solanum lycopersicumMicroTom fruit , mature green389.72
S0711Solanum lycopersicumMicroTom fruit , 11mm to 14mm in diameter3818.3
S0710Solanum lycopersicumMicroTom fruit , 5mm to 7mm in diameter2419.94
S0709Solanum lycopersicumMicroTom fruit , 1mm to 3mm in diameter2815.88
S0708Solanum lycopersicumMicroTom flower, open113.39
S0707Solanum lycopersicumMicroTom flower bud, closed bud before flower blooming6316.54
S0371Solanum lycopersicumHeinz 1706leaf10.3

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00141

genome hit of precursorprecursor
sequence IDstartendstrandsequence folding
energy		miRNA*structure
SL2.40ch023363894233638832- UUCACUCAUGUUUUCGCCAU
CCAACUUUUGGUUCAUGUAU
GUCCAACAUGGCAACUAACG
CCUAUAAAGGCAUAUUUGCA
CCAAAAGUUGGACGGCGAGG
ACAUGAGUGAA		-64.80NA structure