Tomato miRNA M00142
sequence | Length | miRNA family | sRNA ID | target |
GGCAGAGACAAUACCUGAAUAUG | 23 | NA |
S18019913
| NA |
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 2 | 0.19 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 4 | 0.53 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 3 | 0.35 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 8 | 0.59 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 17 | 13.1 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 17 | 12.9 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 7 | 4.99 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 7 | 5.16 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 8 | 5 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 16 | 10.19 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 12 | 7.91 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 15 | 9.17 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 11 | 6.58 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 97 | 94.64 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 72 | 42.03 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 142 | 139.29 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 79 | 55.87 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 76 | 82.73 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 115 | 109.88 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 25 | 72.22 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 13 | 9.06 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 4 | 5.34 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 13 | 5.44 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 11 | 2.77 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 13 | 3.68 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 28 | 7.16 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 2 | 0.96 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 3 | 2.49 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 9 | 2.78 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 13 | 3.41 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 2 | 0.6 |
Hits on known miRNAs
No hits on known miRNAs were found |
Precursor of miRNA M00142
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch02 | 49238939 | 49238751 | - |
CAUACUCAGGUAUUGUCUCU
GCCAUGGGCGGCCAUUCGCU
CUUUUAAUCCCCUCUUAUUG
GCUCGCAGCCUCAAGGGAGA
AUCGAACCCGUGACCUAUGG
CUCCUUUACAUUCCCUUGAG
GCAGCAAGCCAAUAAGAGGG
GAUUAAAAGAGCGAAUGGCC
GCCAAUGGCAGAGACAAUAC
CUGAAUAUG | -143.57 | NA |
structure |
|