Tomato miRNA M00143
sequence | Length | miRNA family | sRNA ID | target |
AUGGCAGAGACAAUACCUGAGUA | 23 | NA |
S11184186
| NA |
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 3 | 0.35 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 1 | 0.22 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 3 | 0.22 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 21 | 16.18 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 13 | 9.86 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 2 | 1.42 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 6 | 4.42 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 14 | 8.74 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 5 | 3.19 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 9 | 5.93 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 7 | 4.28 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 5 | 2.99 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 124 | 120.99 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 226 | 131.93 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 143 | 140.27 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 119 | 84.16 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 43 | 46.81 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 54 | 51.59 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 20 | 57.77 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 1 | 0.7 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 6 | 8.01 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 4 | 1.67 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 3 | 3.07 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 6 | 1.51 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 12 | 3.4 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 39 | 9.98 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 3 | 1.45 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 7 | 5.82 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 2 | 1.13 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 21 | 6.48 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 26 | 6.83 |
Hits on known miRNAs
No hits on known miRNAs were found |
Precursor of miRNA M00143
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch02 | 49238753 | 49238937 | + |
UAUUCAGGUAUUGUCUCUGC
CAUUGGCGGCCAUUCGCUCU
UUUAAUCCCCUCUUAUUGGC
UUGCUGCCUCAAGGGAAUGU
AAAGGAGCCAUAGGUCACGG
GUUCGAUUCUCCCUUGAGGC
UGCGAGCCAAUAAGAGGGGA
UUAAAAGAGCGAAUGGCCGC
CCAUGGCAGAGACAAUACCU
GAGUA | -153.20 | NA |
structure |
|