Tomato miRNA M00146
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 2 | 0.19 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 10 | 1.33 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 8 | 0.93 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 3 | 0.65 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 48 | 3.54 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 79 | 60.88 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 18 | 13.65 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 47 | 33.48 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 53 | 39.03 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 51 | 31.84 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 48 | 30.58 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 64 | 42.18 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 60 | 36.68 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 77 | 46.09 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 37 | 36.1 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 27 | 15.76 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 23 | 22.56 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 44 | 31.12 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 24 | 26.13 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 11 | 10.51 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 3 | 8.67 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 19 | 13.24 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 42 | 56.05 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 23 | 9.62 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 3 | 3.07 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 91 | 22.91 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 167 | 47.33 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 54 | 13.82 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 113 | 54.43 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 278 | 230.95 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 474 | 268.76 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 32 | 9.87 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 67 | 17.59 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 1 | 0.3 |
Hits on known miRNAs
No hits on known miRNAs were found |
Precursor of miRNA M00146
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch02 | 45483356 | 45483477 | + |
GUAAAGUGUCCUUCUUGUCC
GCAUUUGUAGCAUCCCGCUC
CUCCUCCACCGCCUCCUUGG
CUACAUUCCCUUGUGAAAGA
AGGAAGGGGCUGCUACAAAU
GUGGGGAAGAAGGGCAUUUU
GG | -64.00 | NA |
structure |
SL2.40ch02 | 45487053 | 45487174 | + |
GUAAAGUGUCCCUCUUCGCC
GCAUUUGUAGCAUCCCGCUA
UUCCUCCACCGCCUCCCUGG
CUACAUUCCCUUGCGAAAGA
AGGAGGGGGCUGCUACAAAU
GUGGGGAAGAAGGGCAUUUU
GG | -63.50 | NA |
structure |
|