Tomato miRNA M00148

sequenceLengthmiRNA familysRNA IDtarget
UUCGGACAUAGGUUGAGAGGGUA23NA S25120647 click here

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739Solanum lycopersicumAilsa Craigfruit, red ripe (52 days after anthesis)90.88
S0738Solanum lycopersicumAilsa Craigfruit, breaker (42 days after anthesis)10.13
S0737Solanum lycopersicumAilsa Craigfruit, mature green (39 days after anthesis)111.29
S0736Solanum lycopersicumAilsa Craigfruit, immature (17 days after anthesis)30.65
S0735Solanum lycopersicumSunnyleaf , TSWV-infected211.55
S0734Solanum lycopersicumIL8-3-1seedlings, two-week-old 396305.16
S0733Solanum lycopersicumIL8-3seedlings, two-week-old 332251.86
S0732Solanum lycopersicumIL8-2-1seedlings, two-week-old 197140.35
S0731Solanum lycopersicumIL8-2seedlings, two-week-old 223164.23
S0730Solanum lycopersicumIL8-1-3seedlings, two-week-old 393245.39
S0729Solanum lycopersicumIL8-1Dseedlings, two-week-old 358228.06
S0728Solanum lycopersicumIL8-1-1seedlings, two-week-old 452297.89
S0727Solanum lycopersicumIL2-5seedlings, two-week-old 734448.73
S0726Solanum lycopersicumIL1-1seedlings, two-week-old 621371.74
S0725Solanum lycopersicum x S. pennelliiM82 x LA716 (F2)seedlings, two-week-old , replicate3104101.47
S0724Solanum lycopersicum x S. pennelliiM82 x LA716 (F2)seedlings, two-week-old , replicate2174101.58
S0723Solanum lycopersicum x S. pennelliiM82 x LA716 (F2)seedlings, two-week-old , replicate1109106.92
S0722Solanum lycopersicum x S. pennelliiM82 x LA716 (F1)seedlings, two-week-old , replicate28157.29
S0721Solanum lycopersicum x S. pennelliiM82 x LA716 (F1)seedlings, two-week-old , replicate1155168.73
S0720Solanum pennelliiLA716seedlings, two-week-old , replicate210095.55
S0719Solanum pennelliiLA716seedlings, two-week-old , replicate11646.22
S0718Solanum lycopersicumM82seedlings, two-week-old , replicate2329229.19
S0717Solanum lycopersicumM82seedlings, two-week-old , replicate1203270.89
S0716Solanum lycopersicumMicroTom fruit , 7 days post breaker8736.38
S0715Solanum lycopersicumMicroTom fruit , 5 days post breaker5960.33
S0714Solanum lycopersicumMicroTom fruit , 3 days post breaker18346.06
S0713Solanum lycopersicumMicroTom fruit , breaker stage353100.05
S0712Solanum lycopersicumMicroTom fruit , mature green17444.52
S0711Solanum lycopersicumMicroTom fruit , 11mm to 14mm in diameter9244.32
S0710Solanum lycopersicumMicroTom fruit , 5mm to 7mm in diameter6654.83
S0709Solanum lycopersicumMicroTom fruit , 1mm to 3mm in diameter2916.44
S0708Solanum lycopersicumMicroTom flower, open9128.08
S0707Solanum lycopersicumMicroTom flower bud, closed bud before flower blooming5815.23
S0373Solanum lycopersicumHeinz 1706fruit51.5
S0372Solanum lycopersicumHeinz 1706flower10.3

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00148

genome hit of precursorprecursor
sequence IDstartendstrandsequence folding
energy		miRNA*structure
SL2.40ch0515078341507718- UACCCCCUUAAUCUAUGCCA
GAAAUCUCAGAGACACUUAU
ACUAUACUAAGGGGGUAAUA
GGACCACAAUAUAGUAUAAG
UGUGUCUCUGAGAUUUCGGA
CAUAGGUUGAGAGGGUA		-61.70NA structure