Tomato miRNA M00149
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 1 | 0.13 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 2 | 0.23 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 1 | 0.22 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 11 | 0.81 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 18 | 13.87 | | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 39 | 29.59 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 6 | 4.27 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 23 | 16.94 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 25 | 15.61 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 27 | 17.2 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 23 | 15.16 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 36 | 22.01 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 20 | 11.97 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 487 | 475.17 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 479 | 279.63 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 667 | 654.28 | | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 223 | 157.71 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 170 | 185.06 | | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 246 | 235.04 | | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 116 | 335.09 | | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 4 | 2.79 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 14 | 18.68 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 15 | 6.27 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 31 | 7.8 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 9 | 2.55 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 31 | 7.93 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 10 | 4.82 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 6 | 4.98 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 22 | 6.79 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 32 | 8.4 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 3 | 0.9 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 2 | 0.61 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 1 | 0.3 |
Hits on known miRNAs
| No hits on known miRNAs were found |
Precursor of miRNA M00149
| genome hit of precursor | precursor |
| sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
| SL2.40ch10 | 64094133 | 64094355 | + |
AUUCAGGUAUAGUCUCUGCC
AUGGGCGGCCAUUCGCUCUU
UUAAUCCCCUCUUAUUGGCA
UGCAGCCUCAAGGGAGAAUC
GAACCCGUGACCUAUGGCUC
CUUUACAUCCCUCCCAAGGA
GAUCGCCUUUCACCAAUUAA
GCUGCAGCUCCUUGAGGCUG
CAUGCCAAUAAGAGGGGAUU
AAAAGAGCGAAUGGCCGCCC
AUGGCAGAGACAAUACCUGA
AUA | -160.60 | NA |
structure |
| SL2.40ch02 | 49238937 | 49238753 | - |
UACUCAGGUAUUGUCUCUGC
CAUGGGCGGCCAUUCGCUCU
UUUAAUCCCCUCUUAUUGGC
UCGCAGCCUCAAGGGAGAAU
CGAACCCGUGACCUAUGGCU
CCUUUACAUUCCCUUGAGGC
AGCAAGCCAAUAAGAGGGGA
UUAAAAGAGCGAAUGGCCGC
CAAUGGCAGAGACAAUACCU
GAAUA | -141.17 | NA |
structure |
|