Tomato miRNA M00152
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 1 | 0.1 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 2 | 0.27 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 1 | 0.12 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 3 | 0.65 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 115 | 8.48 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 107 | 82.46 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 27 | 20.48 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 70 | 49.87 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 122 | 89.85 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 86 | 53.7 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 57 | 36.31 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 89 | 58.66 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 147 | 89.87 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 115 | 68.84 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 12 | 11.71 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 20 | 11.68 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 11 | 10.79 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 30 | 21.22 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 38 | 41.37 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 23 | 21.98 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 16 | 46.22 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 67 | 46.67 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 77 | 102.75 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 164 | 68.58 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 140 | 143.16 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 276 | 69.47 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 687 | 194.71 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 398 | 101.82 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 711 | 342.49 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 1367 | 1135.62 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 2649 | 1501.99 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 248 | 76.52 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 623 | 163.55 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 1 | 0.3 |
Hits on known miRNAs
No hits on known miRNAs were found |
Precursor of miRNA M00152
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch02 | 45483332 | 45483501 | + |
CCAUCUUCCUGGCUAUAUUC
CCUUGUAAAGUGUCCUUCUU
GUCCGCAUUUGUAGCAUCCC
GCUCCUCCUCCACCGCCUCC
UUGGCUACAUUCCCUUGUGA
AAGAAGGAAGGGGCUGCUAC
AAAUGUGGGGAAGAAGGGCA
UUUUGGAAGGGAUUGUAGGC
AGAGAGAUGG | -98.80 | NA |
structure |
SL2.40ch02 | 45487029 | 45487198 | + |
CCAUCUUCCUGGCUAUAUUC
CCUUGUAAAGUGUCCCUCUU
CGCCGCAUUUGUAGCAUCCC
GCUAUUCCUCCACCGCCUCC
CUGGCUACAUUCCCUUGCGA
AAGAAGGAGGGGGCUGCUAC
AAAUGUGGGGAAGAAGGGCA
UUUUGGAAGGGAUUGUAGGC
AGAGAGAUGG | -98.30 | NA |
structure |
|