Tomato miRNA M00153
sequence | Length | miRNA family | sRNA ID | target |
UUGAAUGUUGGGGAACGAACGUCU | 24 | NA |
S25335887
| NA |
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 55 | 5.36 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 36 | 4.77 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 864 | 100.93 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 120 | 25.84 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 65 | 4.79 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 13 | 5.44 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 2 | 2.05 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 21 | 5.29 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 32 | 9.07 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 19 | 4.86 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 11 | 5.3 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 14 | 11.63 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 10 | 5.67 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 21 | 6.48 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 44 | 11.55 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 68 | 20.35 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 28 | 8.47 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 15 | 4.52 |
Hits on known miRNAs
No hits on known miRNAs were found |
Precursor of miRNA M00153
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch09 | 3057927 | 3057788 | - |
UUGAAUGUUGGGGAACGAAC
GUCUAAGGUUUGGGUCAACG
AUCUCAAUGUUGAUGCGUCC
GCUUGUUGUUGAUGCUGCUC
CAAAAGGUUCAACAUUGGGA
UUUUAGCCCAAACAUCAGAC
GUCCCUUCCCCAUCGUUCAA
| -67.10 | NA |
structure |
|